User:Ppgardne/RfamFamilies to be built

Invite

If you are an author of one of the following articles, then there is a good chance we don't have your family in Rfam yet. Thanks to the journal RNA Biology you can gain recognition for helping us share your RNA with the research community. All you need to do is publish an RNA families article. The requirements are 1) an article 2) a Stockholm formatted alignment with consensus secondary structure annotation and 3) a Wikipedia article.

High priority singletons

1. HIGH PRIORITY: Translation on demand by a simple RNA-based thermosensor
2. HIGH PRIORITY: Widespread Occurrence of Self-Cleaving Ribozymes
   1. Lots of data in the supp mat.
3. HIGH PRIORIY: A PhoQ/P-Regulated small RNA Regulates Sensitivity of Escherichia coli to Antimicrobial Peptides-- RNA Biol. invite sent - 23 Oct 2010
4. HIGH PRIORITY: Evidence for a major role of antisense RNAs in cyanobacterial gene regulation
5. Stem-loop structure of Cocksfoot mottle virus RNA is indispensable for programmed -1 ribosomal frameshifting.
6. HIGH PRIORITY: A discontinuous hammerhead ribozyme embedded in a mammalian messenger RNA
7. HIGH PRIORITY: Update the SgrS model: Homologs of the small RNA SgrS are broadly distributed in enteric bacteria but have diverged in size and sequence The alignment is here, see figure 3 for the secondary structure.
8. HIGH PRIORITY: A noncoding RNA gene on chromosome 10p15.3 may function upstream of hTERT family build but need to write wiki io3
9. HIGH PRIORITY: The other non-coding HARs. Not HAR1F.
   1. An RNA gene expressed during cortical development evolved rapidly in humans
   2. Forces Shaping the Fastest Evolving Regions in the Human Genome
   3. use the ucsc track here
10. HIGH PRIORIY: Messenger RNA targeting to endoplasmic reticulum stress signalling sites
11. HIGH PRIORIY: Palmenberg AC, Spiro D, Kuzmickas R, Wang S, Djikeng A, Rathe JA, Fraser-Liggett CM, Liggett SB. Sequencing and Analyses of All Known Human Rhinovirus Genomes Reveals Structure and Evolution. Science. 2009 Feb 12. -- RNA Biol. invite sent - 23 Oct 2010
12. HIGH PRIORITY: RNA elements associated with an RNA dependent RNA polymerase.
13. HIGH PRIORIY: RivR and the small RNA RivX: the missing links between the CovR regulatory cascade and the Mga regulon.-- RNA Biol. invite sent - 23 Oct 2010
14. HIGH PRIORIY: YFR families:
    1. Yfr1 Nakamura et al. Grab alignments and structure from Voss et al.
    2. See the RT ticket #86616
    3. The Challenge of Regulation in a Minimal Photoautotroph: Non-Coding RNAs in Prochlorococcus
    4. And the Voss et al. article in RNA Biol.
15. HIGH PRIORIY: The rpoS mRNA leader recruits Hfq to facilitate annealing with DsrA sRNA Toby J. Soper1 and Sarah A. Woodson wiki written but need to finish building family
16. HIGH PRIORITY: RNA-mediated epigenetic programming of a genome-rearrangement pathway
17. HIGH PRIORITY: Architecture and secondary structure of an entire HIV-1 RNA genome Check the frameshift element.-- RNA Biol. invite sent - 23 Oct 2010
18. HIGH PRIORIY: Hutton, M.; Lendon, C. L.; Rizzu, P.; Baker, M.; Froelich, S.; Houlden, H.; Pickering-Brown, S.; Chakraverty, S.; Isaacs, A.; Grover, A.; Hackett, J.; Adamson, J.; and 39 others : Association of missense and 5-prime-splice-site mutations in tau with the inherited dementia FTDP-17. Nature 393: 702-705, 1998. PubMed ID : 9641683
    1. omim for text...
19. HIGH PRIORIY: A Strand-Specific RNA–Seq Analysis of the Transcriptome of the Typhoid Bacillus Salmonella Typhi -- models built -- need checking in -- pg5

• Bacillus

1. PMID 14712717 Role of RNA Structure in Transcription Attenuation in Bacillus subtilis: The trpEDCFBA Operon as a Model System
2. The Transcriptionally Active Regions in the Genome of Bacillus subtilis
3. new rfam user email 201206 (pyrG) this?: Regulation of pyrG expression in Bacillus subtilis: CTP-regulated antitermination and reiterative transcription with pyrG templates in vitro
4. Medium priority: PMID 18697947 The Bacillus subtilis iron-sparing response is mediated by a Fur-regulated small RNA and three small, basic proteins
5. Identification of regulatory RNAs in Bacillus subtilis

• Streptococcus

1. PMID 000000 Identification of genes for small non-coding RNAs that belong to the regulon of the two-component regulatory system CiaRH in Streptococcus
2. PMID 20525227 Identification of novel non-coding small RNAs from Streptococcus pneumoniae TIGR4 using high-resolution genome tiling arrays
3. Identification and Characterization of Non-Coding Small RNAs in Streptococcus pneumoniae Serotype 2 Strain D39.

• Mycobacterium

1. Whole-Genome Tiling Array Analysis of Mycobacterium leprae RNA Reveals High Expression of Pseudogenes and Noncoding Regions
2. PMID 20181675 Multiple small RNAs identified in Mycobacterium bovis BCG are also expressed in Mycobacterium tuberculosis and Mycobacterium smegmatis

• Escherichia

1. MEDIUM PRIORITY: UptR RNA:
   1. GenBank: AF272839.1
   2. PMID 11157926 Oversynthesis of a New Escherichia coli Small RNA Suppresses Export Toxicity of DsbA'-PhoA Unfoldable Periplasmic Proteins
2. Medium priority: PMID 20075074 Translational Regulation of Gene Expression by an Anaerobically Induced Small Non-coding RNA in Escherichia coli
3. PMID 9620955 Promoter Region of the Escherichia coli O7-Specific Lipopolysaccharide Gene Cluster: Structural and Functional Characterization of an Upstream Untranslated mRNA Sequence
4. Regulation of clpQ+Y+ (hslV+U+) Gene Expression in Escherichia coli
5. PMID 1722556 Structure of two retrons of Escherichia coli and their common chromosomal insertion site
6. PMID 20407422 Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis

• Salmonella

1. PMID 12892895 msDNA-St85, a multicopy single-stranded DNA isolated from Salmonella enterica serovar Typhimurium LT2 with the genomic analysis of its retron.
2. PMID 12829299 Retron reverse transcriptase rrtT is ubiquitous in strains of Salmonella enterica serovar Typhimurium.
3. PMID 20460466 Experimental identification and characterization of 97 novel npcRNA candidates in Salmonella enterica serovar Typhi

• Staphylococcus aureus

1. Cartography of Methicillin-Resistant S. aureus Transcripts: Detection, Orientation and Temporal Expression during Growth Phase and Stress Conditions
2. Medium priority: PMID 20511587 Experimental discovery of small RNAs in Staphylococcus aureus reveals a riboregulator of central metabolism.
3. PMID 20151104 Identification of differentially expressed small non-protein-coding RNAs in Staphylococcus aureus displaying both the normal and the small-colony variant phenotype
4. A search for small noncoding RNAs in Staphylococcus aureus reveals a conserved sequence motif for regulation.

• Helicobacter pylori

1. HIGH PRIORITY: PMID 20164839 The primary transcriptome of the major human pathogen Helicobacter pylori

• Vibrios

1. 1. A small-RNA-mediated negative feedback loop controls quorum-sensing dynamics in Vibrio harveyi Kimberly C. Tu 1 , Christopher M. Waters 1,2 , Sine L. Svenningsen 1 and Bonnie L. Bassler
   2. PMID 20447992 Identification of non-coding RNAs in environmental vibrios.
   3. Jane M. Liu1, Jonathan Livny2, Michael S. Lawrence3, Marc D. Kimball1, Matthew K. Waldor2 and Andrew Camilli1,Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing

• Candida albicans

1. PMID 20618945 Experimental annotation of the human pathogen Candida albicans coding and noncoding transcribed regions using high-resolution tiling arrays

• Chlamydia

1. PMID 21051342 Developmental expression of non-coding RNAs in Chlamydia trachomatis during normal and persistent growth
2. PMID 19923228 Deep sequencing-based discovery of the Chlamydia trachomatis transcriptome

Singletons

1. PMID 21053272 A coding RNA segment that enhances the ribosomal recruitment of chicken ccn1 mRNA
2. PMID 20460460 A small nucleolar RNA functions in rRNA processing in Caenorhabditis elegans.
3. Medium priority: 17A, a novel non-coding RNA, regulates GABA B alternative splicing and signaling in response to inflammatory stimuli and in Alzheimer disease -- RNA Biol. invite sent 25/10/10
   1. sequence
4. PMID 20739539 An RNA pseudoknot is required for the production of yellow fever virus sfRNA by the host nuclease XRN1.
5. PMID 20601471 CrfA: An sRNA regulator of adaptation to carbon starvation in Caulobacter crescentus.
6. PMID 20581224 An Alu-like RNA promotes cell differentiation and reduces malignancy of human neuroblastoma cells.
7. PMID 19004935 Structural and Functional Studies of the Promoter Element for Dengue Virus RNA Replication
8. PMID 20561661 A Y-shaped RNA structure in the 3′ untranslated region together with the trans-activator and core promoter of Red clover necrotic mosaic virus RNA2 is required for its negative-strand RNA synthesis
9. PMID 20348540 Genomic SELEX for Hfq-binding RNAs identifies genomic aptamers predominantly in antisense transcripts
10. Medium priority: PMID 20559624 The small RNA Aar in Acinetobacter baylyi: a putative regulator of amino acid metabolism -- RNA Biol. invite sent 25/10/10
11. PMID 20532207 An RNA Element at the 5′-End of the Poliovirus Genome Functions as a General Promoter for RNA Synthesis
12. Medium priority: VirR:
    1. PMID 20572941 Stabilization of Clostridium perfringens collagenase mRNA by VR-RNA-dependent cleavage in 5′ leader sequence -- RNA Biol. invite sent 25/10/10
    2. PMID 16102006 VirR, a response regulator critical for Listeria monocytogenes virulence.
    3. Comparative genomics of VirR regulons in Clostridium perfringens strains
13. PMID 20150415 RNPomics: Defining the ncRNA transcriptome by cDNA library generation from ribonucleo-protein particles
14. PMID 20482898 Identification of four novel small non-coding RNAs from Xanthomonas campestris pathovar campestris
15. PMID 20081206 Plant U13 orthologues and orphan snoRNAs identified by RNomics of RNA from Arabidopsis nucleoli
16. PMID 20190049 Transcriptome analysis of Pseudomonas syringae identifies new genes, noncoding RNAs, and antisense activity.
17. RNA Biology -Walter Moss: PMID 20421411 R2 retrotransposons encode a self-cleaving ribozyme for processing from an rRNA co-transcript.
18. PMID 19934254 An internal ribosomal entry site mediates redox-sensitive translation of Nrf2.
19. PMID 8809762 Countertranscript-driven attenuation system of the pAM beta 1 repE gene.
20. PMID 20304999 Abundant 5S rRNA-like Transcripts Encoded by the Mitochondrial Genome in Amoebozoa
21. PMID 20333302 The Complete Genome Sequence of Haloferax volcanii DS2, a Model Archaeon
    1. CRISPR and a snoRNA not in Rfam.
    2. PMID 18844986 RNomics and Modomics in the halophilic archaea Haloferax volcanii: identification of RNA modification genes.
22. PMID 20227418 Heterocyst-specific transcription of NsiR1, a non-coding RNA encoded in a tandem array of direct repeats in cyanobacteria.
23. Medium priority: PMID 20194114 Identification of a structural element of the hepatitis C virus minus strand RNA involved in the initiation of RNA synthesis
24. PMID 19969542 A new type of IRES within gag coding region recruits three initiation complexes on HIV-2 genomic RNA
25. PMID 20174632 ZNF9 Activation of IRES-Mediated Translation of the Human ODC mRNA Is Decreased in Myotonic Dystrophy Type 2.
26. PMID 20176063 A 3' terminal stem-loop structure in Nodamura virus RNA2 forms an essential cis-acting signal for RNA replication.
27. PMID 20150415 RNPomics: Defining the ncRNA transcriptome by cDNA library generation from ribonucleo-protein particles
28. PMID 20129941 A novel antisense RNA regulates at transcriptional level the virulence gene icsA of Shigella flexneri.
29. PMID 20130131 Genomic features and evolutionary constraints in Saffold-like Cardioviruses.
30. PMID 20113528 Identification of novel non-coding RNAs using profiles of short sequence reads from next generation sequencing data
31. PMID 20089193 Genome-wide detection of predicted non-coding RNAs in Rhizobium etli expressed during free-living and host-associated growth using a high-resolution tiling array
32. RNA dependent RNA polymerase of hepatitis C virus binds to its coding region RNA stem-loop structure, 5BSL3.2, and its negative strand
33. Functional analysis of RNA structures present at the 3' extremity of the murine norovirus genome: The variable polypyrimidine tract plays a role in viral virulence
34. The utrophin A 5'UTR drives cap-independent translation exclusively in skeletal muscles of transgenic mice and interacts with eEF1A2.
35. PMID 19884261 A single-base resolution map of an archaeal transcriptome
36. Preferential translation of Hsp83 in Leishmania requires a thermosensitive polypyrimidine-rich element in the 3' UTR and involves scanning of the 5' UTR.
37. Large Intergenic Cruciform-Like Supermotifs in the Lactobacillus plantarum Genome
38. Deep RNA sequencing of L. monocytogenes reveals overlapping and extensive stationary phase and sigma B-dependent transcriptomes, including multiple highly transcribed noncoding RNAs
39. snaR
    1. Novel rapidly evolving hominid RNAs bind nuclear factor 90 and display tissue-restricted distribution
    2. snaR Genes: Recent Descendants of Alu Involved in the Evolution of Chorionic Gonadotropins
40. Yeast RNase III Triggers Polyadenylation-Independent Transcription Termination
41. Secondary structure of the 5' nontranslated regions of hepatitis C virus and pestivirus genomic RNAs.
42. Regulation of Translational Efficiency by Disparate 5' UTRs of PPARgamma Splice Variants.
43. RNA elements within the 5' UTR of West Nile virus genome are critical for RNA synthesis and viral replication.
44. Limited complementarity between U1 snRNA and a retroviral 5' splice site permits its attenuation via RNA secondary structure
45. A new type of IRES within gag coding region recruits three initiation complexes on HIV-2 genomic RNA
46. Deep sequencing analysis of the Methanosarcina mazei Gö1 transcriptome in response to nitrogen availability
47. Non-coding RNA of glutamine synthetase I modulates antibiotic production in Streptomyces coelicolor A3(2)
48. Splicing:
    1. Role of RNA structure in regulating pre-mRNA splicing
49. Euprosterna elaeasa virus genome sequence and evolution of the Tetraviridae family: Emergence of bipartite genomes and conservation of the VPg signal with the dsRNA Birnaviridae family.
50. SECIS elements
    1. Potential SECIS Elements in HIV-1 Strain HXB2
    2. Selenoprotein synthesis in archaea: identification of an mRNA element of Methanococcus jannaschii probably directing selenocysteine insertion
    3. Characterization of Mammalian Selenoproteomes
    4. Heterologous expression of archaeal selenoprotein genes directed by the SECIS element located in the 3' non-translated region
    5. Selenocysteine insertion directed by the 3′-UTR SECIS element in Escherichia coli
    6. Identification of Leishmania selenoproteins and SECIS element
    7. SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes
    8. A selenocysteine tRNA and SECIS element in Plasmodium falciparum
    9. The prokaryotic selenoproteome
    10. Evolutionarily different RNA motifs and RNA–protein complexes to achieve selenoprotein synthesis
51. Giardia snoRNAs (Lesley Collins may write and RNA Biol. article):
    1. Genbank
    2. Identification and evolutionary implication of four novel box H/ACA snoRNAs from Giardia lamblia
    3. snoRNA, a Novel Precursor of microRNA in Giardia lamblia
    4. Identification of 20 snoRNA-like RNAs from the primitive eukaryote, Giardia lamblia
52. URE2 IRES
    1. Internal initiation drives the synthesis of Ure2 protein lacking the prion domain and affects [URE3 propagation in yeast cells]
    2. A Small Stem Loop Element Directs Internal Initiation of the URE2 Internal Ribosome Entry Site in Saccharomyces cerevisiae
    3. Characterization of the functional role of nucleotides within the URE2 IRES element and the requirements for eIF2A-mediated repression
53. An RNA Structural Switch Regulates Diploid Genome Packaging by Moloney Murine Leukemia Virus
54. Stem Loop Sequences Specific to Transposable Element IS605 Are Found Linked to Lipoprotein Genes in Borrelia Plasmids
55. Photooxidative stress induced and abundant small RNAs in Rhodobacter sphaeroides
56. Structural homology between Bamboo mosaic virus and its satellite RNAs in the 5' untranslated region
57. Bioinformatic evidence for a stem-loop structure 5'-adjacent to the IGR-IRES and for an overlapping gene in the bee paralysis dicistroviruses
58. PCA3
59. A global view of the nonprotein-coding transcriptome in Plasmodium falciparum
60. What is our coverage of table 1? -- pretty close to 100% I suspect: An overview of RNAs with regulatory functions in gram-positive bacteria
61. Characterization of the functional role of nucleotides within the URE2 IRES element and the requirements for eIF2A-mediated repression
62. Kinetic mechanism for the binding of eIF4F and tobacco etch virus internal ribosome entry site RNA: effects of eIF4B and poly A binding protein.
63. Limited complementarity between U1 snRNA and a retroviral 5' splice site permits its attenuation via RNA secondary structure.
64. Small RNA-dependent expression of secondary metabolism is controlled by Krebs cycle function in Pseudomonas fluorescens
65. Large telomerase RNA, telomere length heterogeneity and escape from senescence in Candida glabrata
66. An Intergenic Non-Coding rRNA Correlated with Expression of the rRNA and Frequency of an rRNA Single Nucleotide Polymorphism in Lung Cancer Cells
67. The XIAP IRES activates 3′ cistron expression by inducing production of monocistronic mRNA in the βgal/CAT bicistronic reporter system
    1. A new internal-ribosome-entry-site motif potentiates XIAP- mediated cytoprotection
    2. IRESdatabase
    3. iresite
68. Giardiavirus Internal Ribosome Entry Site Has an Apparently Unique Mechanism of Initiating Translation
69. The stimulatory RNA of the Visna-Maedi retrovirus ribosomal frameshifting signal is an unusual pseudoknot with an interstem element
70. Apical Loop-Internal Loop RNA Pseudoknots - A NEW TYPE OF STIMULATOR OF-1 TRANSLATIONAL FRAMESHIFTING IN BACTERIA
71. Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus
72. frameshift elements: -- Andrew Firth
    1. A conserved predicted pseudoknot in the NS2A-encoding sequence of West Nile and Japanese encephalitis flaviviruses suggests NS1' may derive from ribosomal frameshifting.
    2. NS1' of flaviviruses in the Japanese encephalitis serogroup is a product of ribosomal frameshifting and plays a role in viral neuro-invasiveness
    3. NS1' of Flaviviruses in the Japanese Encephalitis Virus Serogroup Is a Product of Ribosomal Frameshifting and Plays a Role in Viral Neuroinvasiveness
    4. Discovery of frameshifting in Alphavirus 6K resolves a 20-year enigma
73. Age- and division-of-labour-dependent differential expression of a novel non-coding RNA, Nb-1, in the brain of worker honeybees, Apis mellifera L.
74. U36C, clan with snR47.
75. Expression of small RNAs in Rhizobiales and protection of a small RNA and its degradation products by Hfq in Sinorhizobium meliloti
76. Two Small RNAs Encoded within the First 1.5 Kilobases of the Herpes Simplex Virus Type 1 Latency-Associated Transcript Can Inhibit Productive Infection and Cooperate To Inhibit Apoptosis
77. Packaging of host mY RNAs by murine leukemia virus may occur early in Y RNA biogenesis -- update the wikipedia entry...
78. Mouse hepatitis virus stem-loop 2 adopts an uYNMG(U)a-like tetraloop structure that is highly functionally tolerant of base substitutions
79. De Novo Computational Prediction of Non-coding RNA Genes in Prokaryotic Genomes
80. Comparative analysis of the large fragment of the 5′ untranslated region (LF-5′ UTR) of serotype A foot-and-mouth disease virus field isolates from India
81. Phylogenetic prediction of cis-acting elements: is there a cre-like sequence in Norovirus genome?
82. Identification of a Conserved RNA Replication Element (cre) within the 3Dpol-Coding Sequence of Hepatoviruses{triangledown}
83. Three discontinuous loop nucleotides in the 3′ terminal stem-loop are required for Red clover necrotic mosaic virus RNA-2 replication
84. Specific and pleiotropic patterns of mRNA regulation by ArcZ, a conserved, Hfq-dependent small RNA
85. Dinoflagellate Spliced Leader RNA Genes Display a Variety of Sequences and Genomic Arrangements
86. Importance of mRNA Secondary Structural Elements for the Expression of Influenza Virus Genes
87. In vitro characterization of a miR-122-sensitive double-helical switch element in the 5' region of hepatitis C virus RNA
88. Structural and functional elements of the promoter encoded by 5'UTR of Venezuelan equine encephalitis virus genome
89. In vitro selection of RNA aptamers derived from a genomic human library, against the TAR RNA element of HIV-1
90. A novel Drosophila antisense scaRNA with a predicted guide function Check Genbank: (Tortoriello) AND "Drosophila melanogaster"[porgn:__txid7227]
91. VS ribozyme
92. Check the mRNA elements descirbed in: The role of mRNA structure in translational control in bacteria
93. RNA secondary structures in the proximal 3′UTR of Indonesian Dengue 1 virus strains
94. Paul is working on this one: Build some Rho-independent transcription terminators models? 1 2 3. Ideally use these. Slurp these.
95. Deletion of a conserved noncoding sequence in Plzf intron leads to Plzf down-regulation in limb bud and polydactyly in the rat
96. Intergenic regions of Borrelia plasmids contain phylogenetically conserved RNA secondary structure motifs
97. PMID 19397915 Secondary structures for 5' regions of R2 retrotransposon RNAs reveal a novel conserved pseudoknot and regions that evolve under different constraints.
98. Genomic structure, chromosomal localization and expression profile of a porcine long non-coding RNA isolated from long SAGE libraries
99. Mapping the Burkholderia cenocepacia niche response via high-throughput sequencing
100. Small RNAs in Haloarchaea: Identification, differential expression and biological function
101. Marchais A, Naville M, Bohn C, Bouloc P, Gautheret D. Single-Pass Classification of all Non-Coding Sequences in a Bacterial Genome Using Phylogenetic Profiles. Genome Res. 2009 Feb 23.
102. CBL-3: Epstein-Barr virus-induced expression of a novel human vault RNA. J Mol Biol. 2009 Mar 16; Authors: Nandy C, Mrázek J, Stoiber H, Grässer FA, Hüttenhofer A, Polacek N
103. Guo L, Allen E, and Miller WA Structure and function of a cap-independent translation element that functions in either the 3 or the 5 untranslated region. RNA 2000; 6(12), 1808-20 AND
104. Khaladkar M, Liu J, Wen D, Wang JT, Tian B. Mining small RNA structure elements in untranslated regions of human and mouse mRNAs using structure-based alignment. 2008 Apr 25;9:189.Click here to read
105. Prediction of Sinorhizobium meliloti sRNA genes and experimental detection in strain 2011 Claudio Valverde1 email, Jonathan Livny2 email, Jan-Philip Schlüter3,4 email, Jan Reinkensmeier5 email, Anke Becker3,4 email and Gustavo Parisi
106. Non-coding RNAs revealed during identification of genes involved in chicken immune responses. Marie-Laure Endale Ahanda1 Contact Information, Thomas Ruby1 Contact Information, Håkan Wittzell, et al.
107. A phage RNA-binding protein binds to a non-cognatenext term structured RNA and stabilizes its core structure Xie MH, Wu QJ, Jiang YF, Bao PH, Zhang Y. Biochem Biophys Res Commun. 2008 Nov 7.
108. Novel long non-protein coding RNAs involved in Arabidopsis differentiation and stress responses Besma Ben Amor1, Sonia Wirth1, Francisco Merchan1, Philippe Laporte1, Yves D'aubenton-Carafa2, Judith Hirsch3, Alexis Maizel1, et al.
109. Julia C. Kenyon, Akela Ghazawi, Winsome K.S. Cheung, et al. The secondary structure of the 5′ end of the FIV genome reveals a long-range interaction between R/U5 and gag sequences, and a large, stable stem–loop.
110. Characterization of 43 Non-Protein-Coding mRNA Genes in Arabidopsis, Including the MIR162a-Derived Transcripts1. Judith Hirsch2,3, Vincent Lefort2,4, Marion Vankersschaver5, Adnane Boualem6, Antoine Lucas, Claude Thermes, Yves d’Aubenton-Carafa, and Martin Crespi Plant Physiology, April 2006, Vol. 140, pp. 1192–1204.
111. ATXN8 opposite strand (non-protein coding)
112. Detection of small RNAs in Pseudomonas aeruginosa by RNomics and structure-based bioinformatic tools Elisabeth Sonnleitner1, Theresa Sorger-Domenigg1, Monika J. Madej2, Sven Findeiss3, Jörg Hackermüller3, Alexander Hüttenhofer2, Peter F. Stadler3, Udo Bläsi1 and Isabella Moll1
113. Small RNA ArrF Regulates the Expression of sodB and feSII Genes in Azotobacter vinelandii Yean-Sung Jung and Young-Man Kwon
114. Androgen responsive intronic non-coding RNAs Rodrigo Louro,1 Helder I Nakaya,1 Paulo P Amaral,1 Fernanda Festa,1 Mari C Sogayar,1 Aline M da Silva,1 Sergio Verjovski-Almeida,1 and Eduardo M Reis
115. Ishii N, Ozaki K, Sato H, Mizuno H, Saito S, Takahashi A, Miyamoto Y, Ikegawa S, Kamatani N, Hori M, Saito S, Nakamura Y, Tanaka T Identification of a novel non-coding RNA, MIAT, that confers risk of myocardial infarction. J Hum Genet. 2006; 51:(12)1087-99
116. Novel noncoding antisense RNA transcribed from human anti-NOS2A locus is differentially regulated during neuronal differentiation of embryonic stem cells. Korneev SA, Korneeva EI, Lagarkova MA, Kiselev SL, Critchley G, O'Shea M.
117. Non-coding RNA as a trigger of neuropathologic disorder phenotypes in transgenic Drosophila Elena Savvateeva-Popova1 Contact Information, Andrej Popov2, Abraham Grossman3, Ekaterina Nikitina1, Anna Medvedeva1, Dmitry Molotkov1, Nicholas Kamyshev1, Konstantin Pyatkov4, Olga Zatsepina5, Natalya Schostak5, Elena Zelentsova5, Galina Pavlova6, Dmitry Panteleev6, Peter Riederer7 and Michail Evgen`ev5
118. Secondary Structure of the rRNA ITS2 Region Reveals Key Evolutionary Patterns in Acroporid Corals Annette W. Coleman and Madeleine J. H. van Oppen
119. A starvation-induced noncoding RNA modulates expression of Dicer-regulated genes
120. Deep Sequencing Analysis of Small Noncoding RNA and mRNA Targets of the Global Post-Transcriptional Regulator, Hfq
121. RNA secondary structure of the feline immunodeficiency virus 5'UTR and Gag coding region
122. Update RNAI wrt this reference, add RNAII.
123. The secondary structure of the HIV-1 transcript modulates viral splicing and infectivity
124. Dai et al The evolution of courtship behaviors through the origination of a new gene in Drosophila PNAS, May 27, 2008, vol. 105 no. 21, 7478-7483
125. Wilhelm et al. Dynamic repertoire of a eukaryotic transcriptome surveyed at single-nucleotide resolution (2008) Nature.
126. Chun-Long Chen et al. Genomewide Analysis of Box C/D and Box H/ACA snoRNAs in Chlamydomonas reinhardtii Reveals an Extensive Organization Into Intronic Gene Clusters (2008) Genetics, Vol. 179, 21-30.
127. Add a Selenocysteine tRNA family? -- see the tRNAscan-SE paper.
128. Ma J, Yan B, Qu Y, Qin F, Yang Y, Hao X, Yu J, Zhao Q, Zhu D, Ao G. (2008) Zm401, a short-open reading-frame mRNA or noncoding RNA, is essential for tapetum and microspore development and can regulate the floret formation in maize.
129. VS ribozyme more recent RNA article
130. HBV post-transcriptional regulatory element
131. mirTrons 1 2 3
132. FMR4: A Novel RNA Transcript with Antiapoptotic Function Is Silenced in Fragile X Syndrome
133. SRA1
     1. PMID 16848684 (structured RNA in ORF?) Alternative Splicing of the First Intron of the Steroid Receptor RNA Activator (SRA) Participates in the Generation of Coding and Noncoding RNA Isoforms in Breast Cancer Cell Lines
     2. PMID 20219889 Expression Profiling Reveals Unexpected Targets and Functions of the Human Steroid Receptor RNA Activator (SRA) Gene.
134. VSRNA A site-specific self-cleavage reaction performed by a novel RNA in neurospora mitochondria
135. Recoding in bacteriophages and bacterial IS elements
136. Evidence for Control of Splicing by Alternative RNA Secondary Structures in Dipteran Homothorax Pre-mRNA
137. Hairpin RNA: a secondary structure of primary importance
138. Bioinformatic and Physical Characterizations of Genome-Scale Ordered RNA Structure in Mammalian RNA Viruses
139. Ultra-conserved ncRNAs.
140. A source of new families?: Jia et al. (2007) Systematic identification of non-coding RNA 2,2,7-trimethylguanosine cap structures in Caenorhabditis elegans. all snoRNA are done,wiki written and DESC completed for sRNAs but not all sRNAs have been finished io3
141. PVT1
142. GlmY Check this isn't the same as GlmY_tke1 -- update wikipedia page...
143. HEPT3, PMID: 17611685.
144. spc operon mRNA, structure is in pdb id:1S03. Seq: GGACGAUGGCGAAACUGCAUGAGGCAAUUCAUGCAAGUCCCUCGUCC
145. EMBL ID: X76506
     1. S.cerevisiae small yeast inhibitor RNA isolated from total RNA.
146. RNA III:
     1. 13. Boisset S, Geissmann T, Huntzinger E, Fechter P, Bendridi N, Possedko M, Chevalier C, Helfer AC, Benito Y, Jacquier A, et al . (2007) Genes Dev 21:1353–1366.
     2. 14. Huntzinger E, Boisset S, Saveanu C, Benito Y, Geissmann T, Namane A, Lina G, Etienne J, Ehresmann B, Ehresmann C, et al . (2005) EMBO J 24:824 – 835.
     3. 15. Mor feldt E, Taylor D, von Gabain A, Ar v idson S (1995) EMBO J 14:4569 – 4577.
147. There are many apparent false-negatives for the 5S rRNA model. Needs fixed/checked.
148. Evolution of rDNA ITS1 and ITS2 sequences and RNA secondary structures within members of the fungal genera Grosmannia and Leptographium
149. Dictyostelium ncRNAs - see the email from Pontus Larsson.
     1. De novo search for non-coding RNA genes in the AT-rich genome of Dictyostelium discoideum: Performance of Markov-dependent genome feature scoring
150. Small non-coding RNAs in Streptomyces coelicolor
151. Identification and Gene Disruption of Small Noncoding RNAs in Streptomyces griseus
152. Systematic identification and characterization of chicken (Gallus gallus) ncRNAs
153. PMID 10531319 Highly specific recognition of primer RNA structures for 2'-OH priming reaction by bacterial reverse transcriptases.
154. PMID 12459273 A partial copy of msDNA from a new retron element is likely a retrotransposed DNA found in the myxobacterium Nannocystis exedens.

Cryptic

1. ???: new Rfams from Alex pmid:1687072
2. ???: Apicomplexan/parasite snoRNA
3. attenuation
4. alex email new families 16/04/07
5. new rfams from sam email 2 emails=26/04/07
6. sam email snoRNA 25/05/07
7. RNA society meeting abstracts..
8. snRNA sam email 14/06/07
9. sam email 25/06/07 new family and expansion email
10. alex email 110707, HCV SL done?

Long RNAs

1. ANRIL
   1. PMID 20956613 ANRIL, a long, noncoding RNA, is an unexpected major hotspot in GWAS.
2. PISRT1
   1. PMID 16137905 Pisrt1, a gene implicated in XX sex reversal, is expressed in gonads of both sexes during mouse development
   2. PMID 19543368 Disease-Causing 7.4 kb Cis-Regulatory Deletion Disrupting Conserved Non-Coding Sequences and Their Interaction with the FOXL2 Promotor: Implications for Mutation Screening
   3. HGNC
3. PMID 20874843 Association of a novel long non-coding RNA in 8q24 with prostate cancer susceptibility.
4. PMID 20214974 Identification of Long stress-induced non-coding transcripts that have altered expression in cancer
5. NCRUPAR:
   1. Entrez Gene
   2. PMID 12084570 A noncoding RNA regulates human protease-activated receptor-1 gene during embryogenesis.
   3. genecards
   4. HGNC
6. RNCR2:
   1. PMID 20459797 The long noncoding RNA RNCR2 directs mouse retinal cell specification.
7. TERRA:
   1. PMID 17916692 Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends.
   2. PMID 20460456 The non-coding RNA TERRA is a natural ligand and direct inhibitor of human telomerase
8. B2 - PMID 20428794 A novel large regulator RNA, B2, partially overlaps the HEF1/NEDD9/Cas-L gene.
9. PRINS - Psoriasis Susceptibility-Related RNA Gene Induced by Stress
   1. PMID 20377629 The anti-apoptotic protein G1P3 is overexpressed in psoriasis and regulated by the non-coding RNA, PRINS
   2. PMID 15855153pfamdb1
   3. GENBANK: NR_023388
10. SONG from Zebrafinch genome paper:
    1. The genome of a songbird
11. MHM ncRNA (Xist for birds...)
    1. PMID 11321370 Transcripts of the MHM region on the chicken Z chromosome accumulate as non-coding RNA in the nucleus of female cells adjacent to the DMRT1 locus.
    2. PMID 18489256 A bird's-eye view of sex chromosome dosage compensation.
12. PMID 17415708 Identification of a novel noncoding RNA gene, NAMA, that is downregulated in papillary thyroid carcinoma with BRAF mutation and associated with growth arrest
13. PMID 20214974 Identification of long stress-responsive non-coding transcripts that have altered expression in cancer
14. PMID 20129396 Identification, bioinformatic analysis and expression profiling of candidate mRNA-like non-coding RNAs in Sus scrofa
15. PMID 20137068 Long noncoding RNAs in neuronal-glial fate specification and oligodendrocyte lineage maturation
16. HULC:
    1. PMID 17241883 Characterization of HULC, a Novel Gene With Striking Up-Regulation in Hepatocellular Carcinoma, as Noncoding RNA
    2. PMID 20423907 CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer.
17. HSR1: Evidence for bacterial origin of heat shock RNA-1
18. Recurrent Focal Copy-Number Changes and Loss of Heterozygosity Implicate Two Noncoding RNAs and One Tumor Suppressor Gene at Chromosome 3q13.31 in Osteosarcoma: LOC285194 and BC040587
19. Prostate cancer antigen 3 (PCA3, also referred to as DD3) is a gene which has noncoding messenger RNA that is overexpressed in prostate cancer.
20. The iStem, a Long-Range RNA Secondary Structure Element Required for Efficient Exon Inclusion in the Drosophila Dscam Pre-mRNA
21. RNCR2 = MIAT = Gomafu
22. Tug1:
    1. New meaning in the message: Noncoding RNAs and their role in retinal development
    2. Young TL, Matsuda T, Cepko CL. 2005. The noncoding RNA taurine upregulated gene 1 is required for differentiation of the murine retina. Curr Biol 15: 501-512.
23. fantom3:
    1. Critical evaluation of the FANTOM3 non-coding RNA transcripts
24. HSR-omega or HSRw or ...
    1. genbank seq
    2. The Developmentally Active and Stress-inducible Non-coding hsr{omega} Gene is a Novel Regulator of Apoptosis in Drosophila
    3. Sequence Evolution of the Drosophila Heat Shock Locus hsr{omega}. I. The Nonrepeated Portion of the Gene
25. Balanced gene regulation by an embryonic brain ncRNA is critical for adult hippocampal GABA circuitry.
26. EGO, a novel, noncoding RNA gene, regulates eosinophil granule protein transcript expression. At GenBank: EGO
27. Finding noncoding RNA transcripts from low abundance expressed sequence tags -- ncR118 is crap! ncR8 looks good.
28. Discovery of functional elements in 12 Drosophila genomes using evolutionary signatures
29. Identification of putative noncoding polyadenylated transcripts in Drosophila melanogaster
30. Conserved introns reveal novel transcripts in Drosophila melanogaster
31. Detection of intergenic non-coding RNAs expressed in the main developmental stages in Drosophila melanogaster
32. Highly upregulated in liver cancer noncoding RNA is overexpressed in hepatic colorectal metastasis.
33. Identification and characterization of human non-coding RNAs with tissue-specific expression
34. Review: The Genetic Signatures of Noncoding RNAs -- not BACE1-AS
35. GTL2 (also called MEG3), also mentioned in plosone and Experimental and Molecular Pathology
    1. Maternally Expressed Gene 3 (MEG3) Noncoding Ribonucleic Acid: Isoform Structure, Expression, and Functions
    2. chr14:100,353,498-100,405,840
    3. PMID 20179190 Maternally Expressed Gene 3, an Imprinted Noncoding RNA Gene, Is Associated with Meningioma Pathogenesis and Progression
    4. PMID 20392836 Increased Expression of Angiogenic Genes in the Brains of Mouse Meg3-Null Embryos.
36. Mico1 and Mico1os: Novel imprinted transcripts from the Dlk1-Gtl2 intergenic region, Mico1 and Mico1os, show circadian oscillations.
37. Gomafu: Sone M, Hayashi T, Tarui H, Agata K, Takeichi M, Nakagawa S. The mRNA-like noncoding RNA Gomafu constitutes a novel nuclear domain in a subset of neurons. J Cell Sci. 2007 Aug 1;120(Pt 15):2498-506.
38. lincRNAs: Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, Huarte M, Zuk O, Carey BW, Cassady JP, Cabili MN, Jaenisch R, Mikkelsen TS, Jacks T, Hacohen N, Bernstein BE, Kellis M, Regev A, Rinn JL, Lander ES. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature. 2009 Mar 12;458(7235):223-7. Epub 2009 Feb 1.
39. ncRAN: Yu M, Ohira M, Li Y, Niizuma H, Oo ML, Zhu Y, Ozaki T, Isogai E, Nakamura Y, Koda T, Oba S, Yu B, Nakagawara A. High expression of ncRAN, a novel non-coding RNA mapped to chromosome 17q25.1, is associated with poor prognosis in neuroblastoma. Int J Oncol. 2009 Apr;34(4):931-8.
40. From OMIM: Chan, A. S.; Thorner, P. S.; Squire, J. A.; Zielenska, M. : Identification of a novel gene NCRMS on chromosome 12q21 with differential expression between Rhabdomyosarcoma subtypes. Oncogene 21: 3029-3037, 2002.
41. From OMIM: Liu, A. Y.; Torchia, B. S.; Migeon, B. R.; Siliciano, R. F. The human NTT gene: identification of a novel 17-kb noncoding nuclear RNA expressed in activated CD4+ T cells. Genomics 39: 171-184, 1997. PubMed ID : 9027504
42. SOX2OT
    1. genbank
    2. From OMIM: SOX2OT :: Fantes, J.; Ragge, N. K.; Lynch, S.-A.; McGill, N. I.; Collin, J. R. O.; Howard-Peebles, P. N.; Hayward, C.; Vivian, A. J.; Williamson, K.; van Heyningen, V.; FitzPatrick, D. R. Mutations in SOX2 cause anophthalmia. Nature Genet. 33: 461-462, 2003.
    3. Complex architecture and regulated expression of the Sox2ot locus during vertebrate development.
43. Transcription of bxd noncoding RNAs promoted by trithorax represses Ubx in cis by transcriptional interference.
44. Imprinted noncoding RNAs
45. NRON RNA
46. Evf1: Evf1. Might be too long...
47. 2-D Structure of the A Region of Xist RNA and Its Implication for PRC2 Association
48. Add structured elements from EvoFold and RNAz partially matching the Xist (hg17 chrX:72824515-72824578, chrX:72,833,900-72,834,200, chrX:72,853,300-72,853,450) and AIR and H19 RNAs.
49. Xist and TSIX,
50. CTN
51. PINK
52. FMR4
53. Zm401
54. Kcnq1ot1
    1. Kcnq1ot1 Antisense Noncoding RNA. 91 kb-long!!
    2. Mohammad F, Pandey RR, Nagano T, Chakalova L, Mondal T, Fraser P and Kanduri C |title=Kcnq1ot1/Lit1 noncoding RNA mediates transcriptional silencing by targeting to the perinucleolar region |journal=Mol Cell Biol|volume=28 |issue=11 |pages=3713–28 |year=2008 |pmid=18299392 |url=http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=18299392 |doi=10.1128/MCB.02263-07
    3. The long noncoding RNA Kcnq1ot1 organises a lineage-specific nuclear domain for epigenetic gene silencing
55. Complex organisation and structure of the ghrelin antisense strand gene GHRLOS, a candidate non-coding RNA gene.
56. NEAT1
    1. Christine M. Clemson1, Corresponding Author Contact Information, E-mail The Corresponding Author, John N. Hutchinson2, Sergio A. Sara4, Alexander W. Ensminger2, 3, Archa H. Fox4, Andrew Chess2 and Jeanne B. Lawrence An Architectural Role for a Nuclear Noncoding RNA: NEAT1 RNA Is Essential for the Structure of Paraspeckles.
    2. Paraspeckles: nuclear bodies built on long noncoding RNA
    3. Sasaki YT, Ideue T, Sano M, Mituyama T, Hirose T. MENepsilon/beta noncoding RNAs are essential for structural integrity of nuclear paraspeckles. Proc Natl Acad Sci U S A. 2009 Feb 24;106(8):2525-30.
    4. Sunwoo H, Dinger ME, Wilusz JE, Amaral PP, Mattick JS, Spector DL. MEN varepsilon/beta nuclear-retained non-coding RNAs are up-regulated upon muscle differentiation and are essential components of paraspeckles. Genome Res. 2009 Mar;19(3):347-59.
57. NEAT2 aka MALAT1
    1. PMID 20149803 Oxytocin stimulates expression of a noncoding RNA tumor marker in a human neuroblastoma cell line
    2. genecards

Noncoding ESTs

1. A Plasmodium falciparum FcB1-schizont-EST collection providing clues to schizont specific genes structure and polymorphism -- could find overlaps with Genome-wide discovery and verification of novel structured RNAs in Plasmodium falciparum

DONE/LOOKED AT

1. [http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=17604720&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum HOTAIR. HOX ncRNAs. - no structured RNA components found in exon
   1. Davis BM, Waldor MK. RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA. Mol Microbiol. 2007 Jul;65(2):373-85. PMID: 17590231
   2. emial from sam 15/11/07 PMID: 17590231 [PubMed - indexed for MEDLINE] RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA.
   3. RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA Brigid M. Davis* and Matthew K. Waldor - WP page built
2. roX:
   1. Also check out Jakob and Stefan's hits to drosophila roX1 and roX2, their predictions don't overlap but are flanking.
   2. An Evolutionarily Conserved Domain of roX2 RNA Is Sufficient for Induction of H4-Lys16 Acetylation on the Drosophila X Chromosome done io3
   3. Regulation of Histone H4 Lys16 Acetylation by Predicted Alternative Secondary Structures in roX Noncoding RNAs
3. Paul has a partial model for this (~pg5/Evf-2-5p): Evf2: (an alternatively spliced form of Evf-1)
   1. Regionalization within the mammalian telencephalon is mediated by changes in responsiveness to Shh.
   2. The Evf-2 noncoding RNA is transcribed from the Dlx-5/6 ultraconserved region and functions as a Dlx-2 transcriptional coactivator
   3. Balanced gene regulation by an embryonic brain ncRNA is critical for adult hippocampal GABA circuitry
   4. Evf2 is famous...

RNA Biology Articles

Published/In-press:

1. SmY
2. Yfr2 AKA Cyano-1
3. Families of H/ACA ncRNA molecules in Trypanosomatids
4. GIR1 -- paul has an alignment somewhere for this, need a WP page.
5. influenza pseudoknot
6. ptaRNA1
7. RsaOG

1. From Paul's warehouse (/warehouse/pfam01/rfam/Users/pg5/data/rfam/new_families)
   1. MicX (see refs below) - WP page built (MicX sRNA)
   2. GABA3-editing
   3. class_II_RNA - RF01571
   4. pH-regulator
   5. FourU
   6. Lambda_thermo
   7. ROSE_2
   8. Evf-2-5p (see refs below)

1. Gabra-3 element (Marie Ohman and Jakob Petersen)

Models to Swap out

1. swap spliceosomal RNA models

Databases to slurp

1. miRbase UPDATED!
2. PseudoBase: suck all the knots out of here.
3. snoRNA: snoRNAbase france downloaded
4. snoRNA: yeast snoRNAdb downloaded
5. snoRNA: Todd Lowe snoRNAdb downloaded
6. snoRNA: plant snoRNAdb downloaded
7. snoRNA: snoopy downloaded
8. snoRNA: snoRNAbase
9. ncRNA: lots DBs from NAR
10. CRISPR - Adam slurped most of these crispr-database
    1. crispi
    2. RegulonDB
    3. regRNA

Too Hard/Problematic/Junk

1. H-InvDB - weird interface
2. snoRNA: Arabidopsis Small RNA Project - all miRNAs

High priority singletons

1. HIGH PRIORIY: RNA antitoxins
   1. Add hok and sok utr element from RDF's book (Transcription Regulation in Prokaryotes)!
   2. RNA antitoxins -- An RNA antitoxin from an Enterococcus faecalis plasmid
   3. An antisense RNA controls synthesis of an SOS-induced toxin evolved from an antitoxin
   4. Wikipedia page for IstR - link
   5. PMID 20156992 Abundance of type I toxin–antitoxin systems in bacteria: searches for new candidates and discovery of novel families
   6. An antisense RNA controls synthesis of an SOS-induced toxin evolved from an antitoxin
2. High priority: PMID 20453032 Recognition and discrimination of target mRNAs by Sib RNAs, a cis-encoded sRNA family
3. High priority: HSURs (Herpesvirus saimiri U RNAs), EBERS, PAN RNA
   1. PMID 17381320 The challenge of viral snRNPs.
   2. PMID 15916956 Small Nuclear RNAs Encoded by Herpesvirus saimiri Upregulate the Expression of Genes Linked to T Cell Activation in Virally Transformed T Cells
   3. HSUR 1 and 2 are the most conserved of all HSURs and are shown to associate with host miRNAs in virally transformed cells.
4. HIGH PRIORIY: FnrS
   1. Reprogramming of Anaerobic Metabolism by the FnrS Small RNA
   2. Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli
5. HIGH PRIORITY: Intergenic transcription is required to repress the Saccharomyces cerevisiae SER3 gene -- grab srg1 seq from genbank
6. HIGH PRIORITY: Analysis of small RNA in fission yeast; centromeric siRNAs are potentially generated through a structured RNA
7. HIGH PRIORIY: A pH-responsive riboregulator
   1. Paul is building this one...
8. HIGH PRIORITY: A variant riboswitch aptamer class for S-adenosylmethionine common in marine bacteria - failed
9. Identification of small RNAs in Mycobacterium tuberculosis
10. HIGH PRIORITY: Missing some of these: -- check the names are consistent with table 1: Homologs of Small Nucleolar RNAs in Archaea
11. HIGH PRIORITY: Identification of candidate structured RNAs in the marine organism 'Candidatus Pelagibacter ubique'. -- another beautiful article from the Breaker lab!
12. HIGH PRIORITY: The Genome Sequence of Taurine Cattle: A Window to Ruminant Biology and Evolution sequence profile - no obvious conserved non-coding region
13. HIGH PRIORIY: Omer et al. Archael snoRNAs.
14. HIGH PRIORITY: Laura A. Kavanaugh, Fred S. Dietrich Non-Coding RNA Prediction and Verification in Saccharomyces cerevisiae
15. HIGH PRIORIY: dos Santos G, Simmonds AJ, Krause HM. A stem-loop structure in the wingless transcript defines a consensus motif for apical RNA transport Development. 2008 Jan;135(1):133-43. Epub 2007 Nov 28. - RF01046
16. SprD -- High priority:
    1. PMID 20532214 A Staphylococcus aureus Small RNA Is Required for Bacterial Virulence and Regulates the Expression of an Immune-Evasion Molecule
    2. PMID 16183745 Small RNA genes expressed from Staphylococcus aureus genomic and pathogenicity islands with specific expression among pathogenic strains -- NB. Check Erratum.
17. HIGH PRIORIY: A search for small noncoding RNAs in Staphylococcus aureus reveals a conserved sequence motif for regulation

• Done:

1. High priority: PMID 20489016 Adaptive Evolution of an sRNA That Controls Myxococcus Development
2. HIGH PRIORIY: The Non-coding RNA gadd7 Is a Regulator of Lipid-induced Oxidative and Endoplasmic Reticulum Stress
   1. Genbank: Cricetulus longicaudatus gadd7 mRNA
3. HIGH PRIORIY: Exceptional structured noncoding RNAs revealed by bacterial metagenome analysis
   1. See the email submission from Zasha
   2. RNAs_present_in_environmental_samples -- moved up to the RNA Biol. articles.
4. HIGH PRIORIY: PMID 20349053 Nematode sbRNAs: Homologs of Vertebrate Y RNAs
5. HIGH PRIORIY: PMID 19098893 A stress-responsive RNA switch regulates VEGFA expression low complexity
6. HIGH PRIORITY: The cspA mRNA Is a Thermosensor that Modulates Translation of the Cold-Shock Protein CspA
   1. RNA Switches Out in the Cold
   2. PMID 20233932 Interactions of the RNA-binding protein, Hfq, with cspA mRNA encoding the major cold-shock protein
7. HIGH PRIORIY: MicX: (Paul has been working on a seed for this...feel free to write the Wikipedia page tho! ;-)
8. Drosophila Wingless RNA structural element. overlap io3
9. The 3′ end of Turnip crinkle virus contains a highly interactive structure including a translational enhancer that is disrupted by binding to the RNA-dependent RNA polymerase overlap io3
10. Identification of in vivo interaction between Hepatitis C Virus core protein and 5' and 3' UTR RNA. overlap io3
11. A tymovirus with an atypical 3′-UTR illuminates the possibilities for 3′-UTR evolution overlap io3
12. The Listeria transcriptional landscape from saprophytism to virulence done io3
13. Expression and Processing of a Small Nucleolar RNA from the Epstein-Barr Virus Genome v-snoRNA sequence:[EMBL:FN376861+-newId FN376861] done io3
14. Novel non-coding RNAs in Dictyostelium discoideum and their expression during development done io3
15. Transcripts of unknown function in multiple-signaling pathways involved in human stem cell differentiation pg5 -- no apparent conservation, no structure
16. Multiple posttranscriptional regulatory mechanisms partner to control ethanolamine utilization in Enterococcus faecalis done io3
17. Guo L, Allen EM, and Miller WA Base-pairing between untranslated regions facilitates translation of uncapped, nonpolyadenylated viral RNA. Mol Cell 2001; 7(5), 1103-9 done io3
18. Suess B, Fink B, Berens C, Stentz R, Hillen W. A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Res. 2004 Mar 5;32(4):1610-4. Print 2004. synthetic io3
19. Apical Loop-Internal Loop RNA Pseudoknots: A NEW TYPE OF STIMULATOR OF-1 TRANSLATIONAL FRAMESHIFTING IN BACTERIA Mazauric et al.done io3
20. A manganese-dependent ribozyme in the 3'-untranslated region of Xenopus Vg1 mRNA done io3
21. The structure of NoRC-associated RNA is crucial for targeting the chromatin remodelling complex NoRC to the nucleolus done io3
22. RNA secondary structures located in the interchromosomal region of human ACAT1 chimeric mRNA are required to produce the 56-kDa isoform done io3
23. McMullan et al. Evidence for a functional RNA element in the hepatitis C virus core gene overlap io3
24. Small non-coding RNAs in Caulobacter crescentus done io3
25. Gilly Padalon-Brauch, Ruth Hershberg, Maya Elgrably-Weiss, Kobi Baruch, Ilan Rosenshine, Hanah Margalit and Shoshy Altuvia (2008) Small RNAs encoded within genetic islands of Salmonella typhimurium show host-induced expression and role in virulence pg
26. Aspergillus ncRNAs done io3
27. Identification of 17 Pseudomonas aeruginosa sRNAs and prediction of sRNA-encoding genes in 10 diverse pathogens using the bioinformatic tool sRNAPredict2 done io3
28. 'Giardia intestinalis' ncRNA candidates. rubbish io3
29. sam email 10/08/07 pmid=17621584
30. An Evolutionarily Conserved Domain of roX2 RNA Is Sufficient for Induction of H4-Lys16 Acetylation on the Drosophila X Chromosome. done io3
31. From alex: glmUS operon pmid=17854828, Vogel August 2007 overlap io3
32. Guanine riboswitch variants from Mesoplasma florum done io3
33. Structural RNAs of known and unknown function identified in malaria parasites by comparative genomics and RNA analysis. done io3
34. Small RNA-induced differential degradation of the polycistronic mRNA iscRSUA done io3
35. A conserved small RNA promotes silencing of the outer membrane protein YbfM overlap io3
36. emial alex: 05/11/07 Proc Natl Acad Sci U S A. 2006 Dec 19;103(51):19490-5. Epub 2006 Dec 12.
37. new families alex email 120707 from zasha.weinberg@yale.edu. See publication.
38. new ribozyme families? 15029187 16141078
39. RF00206 human U54 taken out of family. need metazoan family built.
40. miRNA Rfmas to be rebuilt.
41. RNAallostery ref 16826230 TPP and SAM sensors?
42. piRNA to go in? pmid 16751777 no proof of conservation -- no structure -- short
43. Translation Initiation from the Ribosomal A Site or the P Site, Dependent on the Conformation of RNA Pseudoknot I in Dicistrovirus RNAs overlap io3
44. The Trypanosomatid Signal Recognition Particle Consists of Two RNA Molecules, a 7SL RNA Homologue and a Novel tRNA-like Molecule can't build io3
45. Host-dependent roles of the viral 5′ untranslated region (UTR) in RNA stabilization and cap-independent translational enhancement mediated by the 3′ UTR of Red clover necrotic mosaic virus RNA1 done io3
46. The Listeria transcriptional landscape from saprophytism to virulence done io3
47. An internal antisense RNA regulates expression of the photosynthesis gene isiA io3
48. The Listeria transcriptional landscape from saprophytism to virulence duplicate entry
49. Identification of new noncoding RNAs in Listeria monocytogenes and prediction of mRNA targets done io3
50. A Highly Structured, Nuclease-Resistant, Noncoding RNA Produced by Flaviviruses Is Required for Pathogenicity done by io3
51. Identification and Functional Analysis of 20 Box H/ACA Small Nucleolar RNAs (snoRNAs) from Schizosaccharomyces pombe done io3
52. Mining small RNA sequencing data: a new approach to identify small nucleolar RNAs in Arabidopsis io3
53. A novel sRNA that modulates virulence and environmental fitness of Vibrio cholerae done io3
54. Prakash Chandra Mishra, Anuj Kumar and Amit Sharma (2009) Analysis of small nucleolar RNAs reveals unique genetic features in malaria parasites done io3
55. Jason E. Weil, Michalis Hadjithomas, and Karen L. Beemon Structural Characterization of the Rous Sarcoma Virus RNA Stability Element. done by io3
56. The Hfq-Dependent Small Non-Coding (s) RNA NrrF Directly Mediates Fur-Dependent Positive Regulation of Succinate Dehydrogenase in Neisseria meningitidis. Metruccio MM, Fantappiè L, Serruto D, Muzzi A, Roncarati D, Donati C, Scarlato V, Delany I. J Bacteriol. 2008 Dec 5.
57. A small non-coding RNA of the invasion gene island (SPI-1) represses outer membrane protein synthesis from the Salmonella core genome. Verena Pfeiffer, Alexandra Sittka, Raju Tomer, Karsten Tedin, Volker Brinkmann and Jörg Vogel
58. Evidence of a novel RNA secondary structure in the coding region of HIV-1 pol gene. Qi Wang1,2, Ian Barr1,3, Feng Guo1,3, and Christopher Lee. RNA (2008), 14:1–11. done by io3
59. BS190, BS201 in Bacillus
60. SurA, SurC, polC-ylxS in Bacillus
61. RatA in Bacillus
62. SR1 in Bacillus
63. Novel small RNA-encoding genes in the intergenic regions of Bacillus subtilis. Saito S, Kakeshita H, Nakamura K.
64. Identification of conserved secondary structures and expansion segments in enod40 RNAs reveals new enod40 homologues in plants Alexander P. Gultyaev and Andreas Roussis
65. Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein Hongping Donga, Bo Zhanga and Pei-Yong Shi
66. Isolation and characterization of RNA aptamers specific for the HCV minus-IRES domain I. Nucleic Acids Symp Ser (Oxf). 2008; 493-4 Konno K, Fujita S, Iizuka M, Nishikawa S, Hasegawa T, Fukuda K overlap io3
67. An internal antisense RNA regulates expression of the photosynthesis gene isiA IsrR (iron stress-repressed RNA) duplicated
68. ADAM LOOKING AT Small CRISPR RNAs Guide Antiviral Defense in Prokaryotes tan J. J. Brouns,1* Matthijs M. Jore,1* Magnus Lundgren,1 Edze R. Westra,1 Rik J. H. Slijkhuis,1 Ambrosius P. L. Snijders,2 Mark J. Dickman,2 Kira S. Makarova,3 Eugene V. Koonin,3 John van der Oost
69. An RNA Sensor for Intracellular Mg2+ (2006) Cromie MJ, Shi Y, Latifi T, Groisman EA.
70. NMR-Assisted Prediction of RNA Secondary Structure: Identification of a Probable Pseudoknot in the Coding Region of an R2 Retrotransposon
71. PAUL IS WORKING ON THIS ONE: Expression of a noncoding RNA is elevated in Alzheimer's disease and drives rapid feed-forward regulation of bold beta-secretase
72. Structural Domains Within the 3' UTR of Turnip Crinkle Virus
73. MOCO Riboswitch: Regulski EE, Moy RH, Weinberg Z, Barrick JE, Yao Z, Ruzzo WL, Breaker RR. (2008) A widespread riboswitch candidate that controls bacterial genes involved in molybdenum cofactor and tungsten cofactor metabolism.
74. SAH riboswitch email from Joy Wang. ~pg5/new_families/SAH
75. Send RNA Biology invite when HACA paper is accepted: Elucidating the Role of C/D snoRNA in rRNA Processing and Modification in Trypanosoma brucei
76. IstR-1 sRNA (Vogel pmid 17499044 ) ?
77. 3'UTR ergulatory element of DNA polymerase Beta mRNA. done io3
78. Y RNAs! Split the family up into Y1, Y2, Y3 and Y5? Best to wait until a sequence update has been done so we capture Stadler and Perreault results.
79. Add a separate model for the D. radioduraans Y RNA.
80. Add more metazoan/invertebrate MRP/RNase P sequences from Piccinelli, Rosenblad and Samuelsson. NAR article.
81. rethreshold RF00582 (current is too low).
82. Use local for the U3? Find it in S. cerevisiae.
83. A new 7SK model from this article. Y RNAs - caution Peter Stadler may rebuild the model, U7
84. Sam is building fungal models of spliceosomal RNAs
85. need models for U4atac, U6atac, U11, Rox1, Rox2
86. HGNC naming HACA rfams missing? (ACA3 ACA6 U107 ACA16 U98b ACA23 ACA31 ACA34 ACA36 ACA37 ACA39 ACA3-2 HBI-115 ACA59 ACA60 U17/E1 ACA62 ACA63 ACA64 ACA65 ACA67 HBI-61)
87. Hugo naming CD rfams HBII-115 U55 HBII-202 U74 U75 U76 U80 U84 HBII-251 HBII-180 HBII-296 HBII-316 HBII-336 U94 U96 U97 HBII-419 HBII-420 HBII-429 U104 HBII-436 HBII- 437 HBII-438 HBII-55 HBII-82 14q
88. multiple Rfams=U25 U43 U102: Enrico set name change / check out.
89. cajal body families froom the HGMC list (also U85 pmid 11157760
90. new rfams from alex 29/01/07 2 papers DONE16990549 and DONE 15565159 DONE plus sgsR 17209026
91. new family from sam 20/03/07 http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=17299041&dopt=AbstractPlus
92. new rfam pubcrawler email 25/02/07 pmid=17307818 B2_SINE (looked into this...repeats)

#NO HOMOLOGS: group III catalytic introns

1. Pyrococcus abyssi (Archaea) H/ACA box snoRNAs. See email from Fabrice Leclerc.