Ciliate, dasycladacean and hexamita nuclear code
The ciliate, dasycladacean and Hexamita nuclear code (translation table 6) is a genetic code used by certain ciliate, dasycladacean and Hexamita species.
The ciliate macronuclear code has not been determined completely. The codon UAA is known to code for Gln only in the Oxytrichidae.
The code
[edit]AAs = FFLLSSSSYYQQCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
[edit]| DNA codons | RNA codons | This code (6) | Standard code (1) | |
|---|---|---|---|---|
| TAA | UAA | Gln (Q) | STOP = Ter (*) | |
| TAG | UAG | Gln (Q) | STOP = Ter (*) |
Systematic range
[edit]- Ciliata: Oxytricha and Stylonychia,[1] Paramecium, Tetrahymena, Oxytrichidae and probably Glaucoma chattoni.
- Dasycladaceae: Acetabularia,[2] and Batophora.[3]
- Diplomonadida: Hexamita inflata, Diplomonadida ATCC50330, and ATCC50380.
See also
[edit]References
[edit]This article incorporates text from the United States National Library of Medicine, which is in the public domain. [4]
- ^ Hoffman DC, Anderson RC, DuBois ML, Prescott DM (1995). "Macronuclear gene-sized molecules of hypotrichs". Nucleic Acids Research. 23 (8): 1279–83. doi:10.1093/nar/23.8.1279. PMC 306850. PMID 7753617.
- ^ Schneider SU, Leible MB, Yang XP (1989). "Strong homology between the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase of two species of Acetabularia and the occurrence of unusual codon usage". Molecular & General Genetics. 218 (3): 445–52. doi:10.1007/bf00332408. PMID 2573818. S2CID 31247623.
- ^ Schneider SU, de Groot EJ (1991). "Sequences of two rbcS cDNA clones of Batophora oerstedii: structural and evolutionary considerations". Current Genetics. 20 (1–2): 173–5. doi:10.1007/bf00312782. PMID 1934113. S2CID 13509708.
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 29 January 2016.
External links
[edit]- Keeling PJ, Doolittle WF (1996). "A non-canonical genetic code in an early diverging eukaryotic lineage". The EMBO Journal. 15 (9): 2285–90. doi:10.1002/j.1460-2075.1996.tb00581.x. PMC 450153. PMID 8641293.
 | This genetics article is a stub. You can help Wikipedia by expanding it. |